Categories
Uncategorized

Q1.1: What is the sequence of the complementary DNA strand? Draw it (in capitals) directly below the 5′ to 3′ strand. (1 mark)

MSC-1020: Ymarferion Biofeddygol

MSE-1020: Biomedical Practicals

 Molecular Biology – Answer book

Dr Gwyndaf Roberts

Part 1:      Using Restriction Fragment Length Polymorphisms                  (RFLP) as molecular markers for disease

The Investigation

Activity I: Restriction Enzymes

You have a piece of DNA with the following template strand:

5’AAAGTCGCTGGAATTCACTGCATCGAATTCCCGGGGCTATATATGGAATTCGA-3’

Q1.1:   What is the sequence of the complementary DNA strand? Draw it (in capitals) directly below the 5′ to 3′ strand. (1 mark)

Q1.2:   If you cut this fragment with the restriction enzyme EcoRI you will produce four fragments. The restriction site for EcoRI is 5’-GAATTC-3’, and the enzyme makes a staggered(“sticky end”) cut between G and A on both strands of the DNA molecule.

Based on this information, type out the sequence of the products (both strands) after the DNA fragment above is cut by EcoRI in the order they appear 5’ to 3’ (left to right on the original fragment). An example of the expected format is given. (8 marks)

Text Box: 5’-GCTAGCTAGCTAGC-3’
  3’-ATCGATCGATCGAT-5’

Q1.3:   Why do DNA fragments migrate through the gel from the negatively charged pole to the positively charged pole? (1 mark)

Analysing Results

Calculating the Sizes of Restriction Fragment Length Polymorphisms

Mathematical formulas have been developed for describing the relationship between the molecular weight of a DNA fragment and its mobility (i.e., how far it migrates in the gel). In general, DNA fragments, like the ones in your evidence samples, migrate at rates inversely proportional to the log10 of their molecular weights. For simplicity’s sake, base pair length (bp) is substituted for molecular weight when determining the size of DNA fragments.

Thus, the size in base pair length of a DNA fragment can be calculated using the distance the fragment travels through the gel. To calculate the base pair length, a DNA standard, composed of DNA fragments of known base pair length (in this case a HinDIII digest), is run on the same gel as the unknown fragments (from the BamHI and EcoRI digests) and is then used to create a standard curve.

The standard curve, in this case a straight line, is created by graphing the distance each fragment from the HinDIII digest travelled through the gel versus the log10 of its base pair length.

Stage 1.

Examine the image of the “ideal” gel shown below that includes DNA samples that have been cut with three restriction enzymes, BamHI, EcoRI, and HindIII, to produce Restriction Fragment Length Polymorphisms (RFLPs). Sample D is DNA that has not been cut with enzyme(s).

DNA cut with HindIII provides a set of fragments of known size and serves as a standard (a “DNA ladder”) for comparison.

Q1.4:   What qualitative observations can you make from this gel? (2 marks)

Q1.5:   What quantitative measurements can you make form this gel? (2 marks)

Stage 2.

Using the image of the ideal gel below, measure the distance (in millimetres) that each RFLP migrated from the origin (the well). Do not change the sizes of these images.

You can use the virtual ruler by clicking on it (in the middle of the image) and then dragging it over the gel. For consistency, measure from the front end of each well to the front edge of each band, (i.e., the edge farthest from the well). Enter the measured distances into Table 1.1.

(See * and ** notes below the Table 1.1 for an explanation for why there are only six bands seen in the HinDIII digest)

Text Box: If you should accidently change the size of these images, please reset them to the following dimensions:
Gel image: 11.6 cm x 8 cm
Ruler: 3.26 cm x 12.82 cm
HindIII BamHIEcoRI
Distance travelled (mm)Base pair length (bp) Distance travelled (mm)Base pair length (bp)Distance travelled (mm)Base pair length (bp)
 *27491     
 *23130     
 9416     
 6557     
 4361     
 2322    
 2027    
 **564    
 **125    

Table 1.1: DNA Fragment Migration Distance

* For this “ideal” gel, assume that these two bands appear as a single band instead of resolving into separate bands.

** These bands do not appear on the ideal gel and likely will not be seen.

Stage 3.

Note that in plotting the standard curve, calculating the log10 of the base pair length of each fragment is unnecessary because the base pair size is plotted on the logarithmic axis of semi-log graph paper.

  1. Label the semi-log graph paper: Choose your scales so that the data points are well spread out. Assume the first cycle on the y-axis represents 100-1,000 base pairs and the second cycle represents 1,000-10,000 base pairs.
  2. For each HindIII digest fragment, plot the measured migration distance versus its size in base pairs.
  3. Draw the line of best fit. This should have approximately equal numbers of points scattered on each side of the line. Some points may be right on the line (see Figure 1.7 for an example). However, you should ignore the point plotted for the 27,491bp/23,130 doublet. When using 0.8% agarose gel, these fragments appear as one.

(5 marks)

Q1.6:   Your best-fit line is the standard curve. Use this to determine the sizes in base pairs of each RFLP from the BamHI and EcoRI digests. Refer to Figure 1.7 for an example. Add your answers to Table 1.1. (5 marks)

Figure 1.7: Please note that while this graph is a very good example of what you should produce, there are several basic errors in the formatting of this graph.

Part 2:      Using RT-qPCR to test for SARS-CoV-2

The Investigation

Activity II: RT-PCR

Q2.1:   Look at the graph below showing qPCR results. Imagine that a PCR was done on these same four samples and that at cycle 25 you stopped the PCR and ran an agarose gel of the four samples. Explain what the four lanes of your gel would look like. Defend your answer with evidence from the graph. (4 marks)

Q2.2:   If a DNA sample, F, has a Ct value that is 3 cycles greater than another sample, Q, what is the concentration of your sequence of interest in sample F relative to sample Q? Explain how you got your answer. (3 marks)

Q2.3:   The WHO recommends including five positive controls (in duplicate) for their quantitative PCR protocol for the detection of SARS-CoV-2. What might these controls be? (2 marks)

Q2.4:   What would be a sensible negative control for this assay, and why is it important to include one? (2 marks)

Analysing Results

References values:
(arbitrary units):
Cycle 10:
Cycle 13:
Cycle 16:
Cycle 19:
Cycle 22:
Cycle 25:
Cycle 28:
Cycle 30:

Analysing the real-time fluorescence during a PCR reaction

RT-qPCR Fluorescence Values
 Samples
CycleNegative controlHigh DNA titerLow DNA titer
    
    
    
    
    
    
    
    
  • Download your own copy of the Excel Spreadsheet from Blackboard.
  • For each cycle analysed, use the reference values to judge the fluorescence of your sample tubes and give each an arbitrary value.
  • Enter your data into the table on the spreadsheet

(3 marks)

  • Highlight cells A4 to D12 and “insert” a scatter chart.
  • Choose the appropriate “Scatter with lines and markers” option.
  • Format your graph correctly.
  • Rename your Excel spreadsheet to include your name and your Bangor University username, e.g. “PCR results_Lisa Simpson_lms20qcp”, and then upload it with the online Answer sheet.

(3 marks)

Q2.5:   What are your conclusions from this SARS-CoV-2 test? (3 marks)

Leave a Reply

Your email address will not be published.