Categories
Uncategorized

Compare and contrast Gilgamesh and Enkidu and explain why, in your opinion, they become such close friends.

Page 1

The Epic of Gilgamesh Discussion Board

For this assignment, you will answer each question below by writing a paragraph of 5-7 sentences per question, for a total of three paragraphs. (90 points)

Compare and contrast Gilgamesh and Enkidu and explain why, in your opinion, they become such close friends.

What role do the women play in The Epic of Gilgamesh? Are they important to the plot? Be specific.

Define a theme (there are many) in The Epic of Gilgamesh and cite specific examples from the story that point to the theme you have chosen.

Myth: a legendary or a traditional story that usually concerns an event or a hero, with or without using factual or real explanations, particularly concerning demigods or deities, and describing some rites, practices, and natural phenomenon; typically, a myth involves historical events and supernatural beings.

Plot: the sequence of events that make up a story, whether it’s told, written, filmed, or sung; the plot is the story, and more specifically, how the story develops, unfolds, and moves in time

Theme: a main idea or central concern of the story that explores any facet of the human condition; examples of theme are many, but consider the following: love, loss, joy, death, birth, suffering, hope, despair, power, corruption, self-discovery, courage, etc.

Page 2:

The Great Flood Discussion Board

For this assignment, write an 8-10 sentence paragraph comparing and contrasting the great flood narratives in The Epic of Gilgamesh and in Genesis. Cite specific examples from each story to highlight the similarities and differences between these two narratives

Literary Terms:

Metaphor: a common figure of speech that makes a comparison by directly relating one thing to another unrelated thing. Unlike similes, metaphors do not use words such as “like” or “as” to make comparisons. The writer or speaker relates the two unrelated things that are not actually the same, and the audience understands that it’s a comparison, not a literal equation. The word comes from a Latin phrase meaning “to carry across,” and a metaphor does just that—it carries a shared quality or characteristic across two distinct things.

Narrative: a spoken or written account of connected events; a story.

Categories
Uncategorized

How is creativity a product of society

Please read articles (by Durkheim and Meyer) linked here and posted under course resources as Optional Reading Packet-1 and watch videos, below. Then, reply to one of these two questions:

1. In Durkheim’s classic study on Suicide, he explained suicide by social, rather than psychological or biological phenomena. Other things, similarly, can be explained from this sociological perspective. For instance, creativity. Please watch the following video and answer this question:

How is creativity a product of society — do you think that it is? Note: You might want to bring the Durkheim article into this discussion.

“Where Good Ideas Come From,” Creativiiquty as a Site of Sociological Inquiry

How is creativity a product of society — do you think that it is? Note: You might want to bring the Durkheim article into this discussion. “Where Good Ideas Come From,” Creativity as a Site of Sociological Inquiry

Categories
Uncategorized

Author a survey/report on one of the following belief systems: Animism, Atheism, Deism, Henotheism, Monotheism, Mysticism, Pantheism, Polytheism, Theism, or Totemism.

Research Paper Prompts – Choose One

Due Date – Midnight, March 14

  1. Author a survey/report on one of the following belief systems: Animism, Atheism, Deism, Henotheism, Monotheism, Mysticism, Pantheism, Polytheism, Theism, or Totemism. A strong paper will include a historical overview of the belief system in question (i.e., its origins and developments), concrete examples of the system in action (i.e., specific religions; their practices/beliefs), and a brief comparison with the tenets of another system for the sake of illuminating the ideas under consideration. Food for thought: What are the advantages/disadvantages of believing in multiple gods versus one god or no god?

OR

  • Compose a survey/report on the role/status of women in one of the following traditions: Christianity, Judaism, Islam, Hinduism, or Buddhism. A strong paper should narrow the discussion to one or two countries and include a discussion on the roles and rights of women in both the religious and secular spheres. Possible subtopics for this survey might include marriage, divorce, sex, menstruation, childbirth, clothing, participation in organized religion, and/or governmental service (choose two or three at most). Food for thought: Eight Muslim majority countries have elected female heads of state since 1988, but the USA has never followed suit. Are the rights and privileges of women in Christianity and Judaism, measurably better than those of Islam?

OR

  • Author a critical review on one of the following documentaries: “Bells from the Deep,” “One of Us,” “The Hidden Art of Islam,” “Believer,” or “Unmistaken Child.” A strong paper will include a short summary of the documentary’s contents, a brief description of the history, beliefs, and practices of the religious community that is being highlighted, and a detailed commentary/analysis of the strengths and weaknesses of the documentary. Food for thought: Is the portrayal of the religious community under consideration positive, negative, or neutral? How do the practices of the community in question differ from, or parallel, the religious beliefs of mainstream America? Does the documentary encourage the acceptance and understanding of religious diversity or is the film attempting to do something else?

OR

  • Author an argumentative paper that answers the question “What is religion?” A strong paper will include a discussion on the problems associated with defining the word “religion,” detailed examples to support your arguments, and a definition for the word “religion” that is sensitive to the places where secular (i.e., non-religious) and religious activities and organizations overlap. Food for thought: Is it possible to define the word “religion?” Can “religion” be defined in a way that includes all the world’s belief systems?

General Requirements for the Paper:

  1. Your name, submission date, and the name/section of the course (top of first page);
    1. The paper’s title (first page; before the body of the text);
    1. A thesis statement or statement of intent at the end of your first or second paragraph;
    1. Page numbers throughout (except first page);
    1. Double-spacing throughout (single for headers, footnotes, endnotes, and bibliography);
    1. Size 12 font for the body (Arial, Calibri, or Times New Roman), Size 11 for block quotes, and size 10 for footnotes/endnotes (if used);
    1. 2100 to 3000 words in length (7 to 10 full pages);
    1. A Bibliography (everything you have read or quoted in the course of writing the paper);
    1. A minimum of 6 resources;

Writing Rubrics

GradeCriteria
A (90-100)– Overall, the essay is of superior quality in most, if not all, aspects. -Essay begins with an attention grabbing introduction and contains a clear and specific thesis in the appropriate location. -The body paragraphs begin with topic sentences that support the thesis. A variety of evidence/support is given for the topic sentence, and transitions are used to show how the ideas connect. The body paragraphs end with concluding sentences. -The conclusion brings the essay to a satisfactory end and does not introduce new points. It reinforces the importance of the subject and content presented. -Essay is well organized and contains few grammar errors. -Essay is sufficient in length and development.
B (80-89)Essay meets or exceeds most of the established criteria.Introduction introduces subject, tone, and contains a clear thesis, and, at the least, attempts to be attention grabbing.Topic sentences are present and clear in each body paragraph. Most body paragraphs are well developed, although one or more would benefit from further development. Evidence is abundant, although a greater variety would make point(s) more clear. Transitions are present and abundant in most areas. Conclusion brings essay to a satisfactory end, although it may be a bit too repetitive or may begin with a trite expression.Organization makes sense and advances essay.Grammar errors are infrequent and certainly do not detract from delivery of content/information.
  
C (70-79)Essay has occasional problems mixed with successful content.Introduction announces subject but is otherwise uninteresting.Most ideas/body paragraphs are well developed, although some should be developed further. Some topic sentences are better than others, but they are all present. Some transitions between sentences are present, but more are needed.Conclusion is too repetitive and doesn’t effectively focus on importance of information.Essay would benefit from better organization, although it is not a major problem.Essay contains more grammar problems than it should, but these problems do not affect the overall delivery of content/information.
D (60-69)Essay has significant problems that detract from the overall quality.Introduction and conclusion are short and inefficient. Thesis is present but not entirely clear.Not all body paragraphs and/or ideas are developed properly. Topic sentences do not control paragraphs. Transitions are sparse, if not non-existent.Much of the essay is unfocused and unorganized.Grammar problems detract from the overall content of the information.
F (0-59)Essay is lacking in a majority of the necessary criteria.Thesis is non-existent or ineffective.Both the introduction and conclusion are ineffective.It lacks a clear focus, has organizational problems, and is insufficient in length and development of ideas.Essay contains numerous grammatical errors and, because of this, is often incoherent.
Categories
Uncategorized

Explain effective communication norms in a business setting.

Research Paper

The Research Paper will be a comprehensive research review of the significant principles of management communications used to successfully achieve organizational objectives. For this assignment of a minimum of eight pages, you need to integrate material from the readings, multimedia, and class discussion boards, and also reflect on professional experience where possible.

It is mandatory to include research from the classroom text as well as from six scholarly sources to support your views. Consider the validity of your resources carefully before using them in academic papers. Use at least one professional example to address the topics below. The following components must be included in order for the paper to be complete:

Explain effective communication norms in a business setting.

Describe the role of interpersonal communication both as a manager and as an employee. What specific techniques have you used to overcome barriers to communication? Be sure to specify your role in the communication.

Explore the role of international and intercultural interpersonal communications in today’s global businesses. Describe both verbal and nonverbal management communication.

Explain approaches for effective written management communication. Analyze various approaches for engaging an audience during a presentation and encouraging active listening.

Describe effective methods of conflict resolution. Analyze techniques for leading teams and group meetings.

Writing the Research Paper The Research Paper: Must be eight to ten double-spaced pages in length (not including the title and reference pages), and formatted according to APA style as outlined in the University of Arizona Global Campus Writing Center. Must include a title page with the following: Title of paper Student’s name Course name and number Instructor’s name Date submitted Must begin with an introductory paragraph that has a succinct thesis statement.

Must address the topic of the paper with critical thought. Must end with a conclusion that reaffirms your thesis. Must use at least six scholarly resources, including a minimum of three from the University of Arizona Global Campus Online Library. Must document all sources in APA style, as outlined in the University of Arizona Global Campus Writing Center. Must include a separate reference page, formatted according to APA style as outlined in the University of Arizona Global Campus Writiiqung Center.

Categories
Uncategorized

Study, and discuss how this text , La Seine etait rouge/ The Seine was Red is linked to this course’s topics.

Study, and discuss how this text , La Seine etait rouge/ The Seine was Red is linked tothis course’s topics. Due March 21 at 11:59 pm. 4 pages minimum, double-spaced, one inch margins, 12 pt Times or Palatino.

The essay does not have to follow the narrative in order. Just determine the elements (limit them to the 3 most important ones) that best answer the question, and find the characteristics that best illustrate your point, and explain why and how the meaning is achieved . Avoid repeating what the text says in a different way.

Transition from one point to the other by concluding the preceding point and introducing the next point. Introductions and Conclusions are important, too. In the introduction (like the word indicates), you present the topics you are going to study, and in the Conclusiiquon , you show how you have achieved proving your points.

Categories
Uncategorized

Write a short descriptive essay that defines and explains selected environmental impacts of deforestation

In your course, turn to Lesson 4. Skim through it to refresh your memory. Next, carefully study and review the section titled, “Ecological Challenges Facing Humanity.” Skim through that and then focus on the topic of deforestation.

Using your own words, write a short descriptive essay that defines and explains selected environmental impacts of deforestation. As you write, imagine you are talking to a friend who has no knowledge of this topic. In short, write the way you speak, using a conversational tone. Also, try to alternate short sentences and longer sentences to make your writing more readable. Be sure to create a title and cite yourself as the author. For example: Environmental Impacts of Deforestation Jennifer Croft Your essay should include five paragraphs, as follows:

Paragraph 1 is your lead paragraph. It will contain an overview of what you have to say about these three topics: disruption of the carbon cycle, disruption of the hydrologic (water) cycle, and the reduction of species diversity. Paragraphs 2, 3, and 4, are your body paragraphs.

Paragraph 2 should describe how deforestation disrupts the carbon cycle.

In paragraph 3, you’ll write about how deforestation disrupts the hydrologic (water) cycle.

In paragraph 4, you’ll explain how deforestation is related to declining species diversity. Paragraph 5 is your conclusion paragraph. Here, you can describe how you feel about the three effects of deforestation discussed, and what we might do about it. It’s permissible to use direct quotes from your reading, but don’t use too many.

One to three such quotes should be your limit. Be sure to put a direct quote in quotation marks. For example: According to Smith, “Carbon dioxide is both our friend and our enemy.” Begin by writing a first draft. Then, edit and rework your material to make it clear and concise. After you have reached a final draft, proofread the essay one last time to locate and correiquct grammar and spelling errors.

Categories
Uncategorized

Develop an “intake” briefing for a group of software engineers who have been tasked with developing a standard set of security review processes for virtual teams

Your Task: Develop an “intake” briefing for a group of software engineers who have been tasked with developing a standard set of security review processes for virtual teams. The purpose of these processes is to ensure that compliance for software security requirements is verified resulting in software applications and software-based products where security is “built in.”

The company also intends that these processes be used towards the organization’s achievement of Capability Maturity Model Integration (CMMI) Level 3 — Defined.

Background: Software development is a complex task, especially as technology changes at the speed of light, environments evolve, and more expectations are placed upon vendors who want to be competitive within the software market. Many software development organizations also depend upon virtual teams whose members are geographically dispersed.

This complexity also makes implementing and testing security features (for software applications) much more challenging. Format: This week, the format for your deliverable (posting) will be “Talking Points.” Talking points are presented in outline format and contain the content that you would put on slides in a slide deck.

Your outline should include 5 to 7 major points (“slide titles”) followed by 3 to 5 supporting points for each. Remember to put enough information into the talking points that your peer reviewers can understand what you intend to cover in each section of your briefing.

Remember to introduce the topic at the beginning, present your analysis, and then close your briefing with an appropriate summary. Include a list of sources (3 or more) which attendees could refer to if they wish to fact check your work. Font: Timiques New Roman Font Size: 9

Categories
Uncategorized

WebTech Development of Austin, Texas, is considering the possible introduction of a new product proposed by its research and development staff

Show your work or no credit will be awarded.   You can write on this then scan and upload it to Canvas.

  1. WebTech Development of Austin, Texas, is considering the possible introduction of a new product proposed by its research and development staff. The firm’s marketing director estimates the product can be marketed at a price of $70. Total fixed cost is $278,000, and average variable cost is calculated at $48. 
  1. What is the breakeven point in units for the proposed product?
  • The firm’s CEO has suggested a target profit return of $214,000 for the proposed product. How many units must be sold to both break even and achieve this target return?
  •  Consider a product with an invoice of $1.87 and a selling price of $4.99. 
  1. Calculate the Markup percentage on selling price
  • Calculate the Markup percentage on cost
  • A consumer purchases a toaster from a retailer for $19.99.  The retailer’s markup is 30%, and the wholesaler’s markup is 10%, both based on selling price.  For what price does the manufacturer sell the product to the wholesaler?

Cost at each level = price – (price X markup%)

Categories
Uncategorized

Q1.1: What is the sequence of the complementary DNA strand? Draw it (in capitals) directly below the 5′ to 3′ strand. (1 mark)

MSC-1020: Ymarferion Biofeddygol

MSE-1020: Biomedical Practicals

 Molecular Biology – Answer book

Dr Gwyndaf Roberts

Part 1:      Using Restriction Fragment Length Polymorphisms                  (RFLP) as molecular markers for disease

The Investigation

Activity I: Restriction Enzymes

You have a piece of DNA with the following template strand:

5’AAAGTCGCTGGAATTCACTGCATCGAATTCCCGGGGCTATATATGGAATTCGA-3’

Q1.1:   What is the sequence of the complementary DNA strand? Draw it (in capitals) directly below the 5′ to 3′ strand. (1 mark)

Q1.2:   If you cut this fragment with the restriction enzyme EcoRI you will produce four fragments. The restriction site for EcoRI is 5’-GAATTC-3’, and the enzyme makes a staggered(“sticky end”) cut between G and A on both strands of the DNA molecule.

Based on this information, type out the sequence of the products (both strands) after the DNA fragment above is cut by EcoRI in the order they appear 5’ to 3’ (left to right on the original fragment). An example of the expected format is given. (8 marks)

Text Box: 5’-GCTAGCTAGCTAGC-3’
  3’-ATCGATCGATCGAT-5’

Q1.3:   Why do DNA fragments migrate through the gel from the negatively charged pole to the positively charged pole? (1 mark)

Analysing Results

Calculating the Sizes of Restriction Fragment Length Polymorphisms

Mathematical formulas have been developed for describing the relationship between the molecular weight of a DNA fragment and its mobility (i.e., how far it migrates in the gel). In general, DNA fragments, like the ones in your evidence samples, migrate at rates inversely proportional to the log10 of their molecular weights. For simplicity’s sake, base pair length (bp) is substituted for molecular weight when determining the size of DNA fragments.

Thus, the size in base pair length of a DNA fragment can be calculated using the distance the fragment travels through the gel. To calculate the base pair length, a DNA standard, composed of DNA fragments of known base pair length (in this case a HinDIII digest), is run on the same gel as the unknown fragments (from the BamHI and EcoRI digests) and is then used to create a standard curve.

The standard curve, in this case a straight line, is created by graphing the distance each fragment from the HinDIII digest travelled through the gel versus the log10 of its base pair length.

Stage 1.

Examine the image of the “ideal” gel shown below that includes DNA samples that have been cut with three restriction enzymes, BamHI, EcoRI, and HindIII, to produce Restriction Fragment Length Polymorphisms (RFLPs). Sample D is DNA that has not been cut with enzyme(s).

DNA cut with HindIII provides a set of fragments of known size and serves as a standard (a “DNA ladder”) for comparison.

Q1.4:   What qualitative observations can you make from this gel? (2 marks)

Q1.5:   What quantitative measurements can you make form this gel? (2 marks)

Stage 2.

Using the image of the ideal gel below, measure the distance (in millimetres) that each RFLP migrated from the origin (the well). Do not change the sizes of these images.

You can use the virtual ruler by clicking on it (in the middle of the image) and then dragging it over the gel. For consistency, measure from the front end of each well to the front edge of each band, (i.e., the edge farthest from the well). Enter the measured distances into Table 1.1.

(See * and ** notes below the Table 1.1 for an explanation for why there are only six bands seen in the HinDIII digest)

Text Box: If you should accidently change the size of these images, please reset them to the following dimensions:
Gel image: 11.6 cm x 8 cm
Ruler: 3.26 cm x 12.82 cm
HindIII BamHIEcoRI
Distance travelled (mm)Base pair length (bp) Distance travelled (mm)Base pair length (bp)Distance travelled (mm)Base pair length (bp)
 *27491     
 *23130     
 9416     
 6557     
 4361     
 2322    
 2027    
 **564    
 **125    

Table 1.1: DNA Fragment Migration Distance

* For this “ideal” gel, assume that these two bands appear as a single band instead of resolving into separate bands.

** These bands do not appear on the ideal gel and likely will not be seen.

Stage 3.

Note that in plotting the standard curve, calculating the log10 of the base pair length of each fragment is unnecessary because the base pair size is plotted on the logarithmic axis of semi-log graph paper.

  1. Label the semi-log graph paper: Choose your scales so that the data points are well spread out. Assume the first cycle on the y-axis represents 100-1,000 base pairs and the second cycle represents 1,000-10,000 base pairs.
  2. For each HindIII digest fragment, plot the measured migration distance versus its size in base pairs.
  3. Draw the line of best fit. This should have approximately equal numbers of points scattered on each side of the line. Some points may be right on the line (see Figure 1.7 for an example). However, you should ignore the point plotted for the 27,491bp/23,130 doublet. When using 0.8% agarose gel, these fragments appear as one.

(5 marks)

Q1.6:   Your best-fit line is the standard curve. Use this to determine the sizes in base pairs of each RFLP from the BamHI and EcoRI digests. Refer to Figure 1.7 for an example. Add your answers to Table 1.1. (5 marks)

Figure 1.7: Please note that while this graph is a very good example of what you should produce, there are several basic errors in the formatting of this graph.

Part 2:      Using RT-qPCR to test for SARS-CoV-2

The Investigation

Activity II: RT-PCR

Q2.1:   Look at the graph below showing qPCR results. Imagine that a PCR was done on these same four samples and that at cycle 25 you stopped the PCR and ran an agarose gel of the four samples. Explain what the four lanes of your gel would look like. Defend your answer with evidence from the graph. (4 marks)

Q2.2:   If a DNA sample, F, has a Ct value that is 3 cycles greater than another sample, Q, what is the concentration of your sequence of interest in sample F relative to sample Q? Explain how you got your answer. (3 marks)

Q2.3:   The WHO recommends including five positive controls (in duplicate) for their quantitative PCR protocol for the detection of SARS-CoV-2. What might these controls be? (2 marks)

Q2.4:   What would be a sensible negative control for this assay, and why is it important to include one? (2 marks)

Analysing Results

References values:
(arbitrary units):
Cycle 10:
Cycle 13:
Cycle 16:
Cycle 19:
Cycle 22:
Cycle 25:
Cycle 28:
Cycle 30:

Analysing the real-time fluorescence during a PCR reaction

RT-qPCR Fluorescence Values
 Samples
CycleNegative controlHigh DNA titerLow DNA titer
    
    
    
    
    
    
    
    
  • Download your own copy of the Excel Spreadsheet from Blackboard.
  • For each cycle analysed, use the reference values to judge the fluorescence of your sample tubes and give each an arbitrary value.
  • Enter your data into the table on the spreadsheet

(3 marks)

  • Highlight cells A4 to D12 and “insert” a scatter chart.
  • Choose the appropriate “Scatter with lines and markers” option.
  • Format your graph correctly.
  • Rename your Excel spreadsheet to include your name and your Bangor University username, e.g. “PCR results_Lisa Simpson_lms20qcp”, and then upload it with the online Answer sheet.

(3 marks)

Q2.5:   What are your conclusions from this SARS-CoV-2 test? (3 marks)

Categories
Uncategorized

1) Complete these explorations of ethical issues in community corrections:

The pressing problem of overcrowding in prisons has led many to turn to alternatives to incarceration as a solution to dealing with our large population in need of correctional supervision. Community corrections are used to reduce overcrowding in prisons and minimize the negative effects that occur as a result of interacting with the criminal justice system. Moreover, community corrections offer a number of benefits, including cost savings (intermediate sanctions such as probation and parole are less expensive than traditional incarceration) and social benefits (individuals on probation/parole are employed in the community, contributing to the tax base, supporting themselves, and better able to maintain prosocial relationships with friends, family, and children). 

There are a number of challenges associated with community corrections. As your readings note, working in this field can be a minefield of ethical contradictions and dilemmas, as community correctional officers are increasingly expected to fulfill dual roles–they are expected to play the role of enforcer of conditions of probation AND, simultaneously, the role of social worker. This can be especially difficult, as the conditions of probation are sometimes difficult, if not impossible, for many individuals to meet. Thus, criminal justice professionals working in community corrections are placed in an extremely difficult ethical position–as much as they seek to encourage/help those they are supervising, they are also tasked with enforcing sometimes stringent requirements that may undermine a probationer/parolee’s success. 

To begin our discussion of ethics and community corrections, please:

1) Complete these explorations of ethical issues in community corrections:

· Reading Two: Miller – The Synthetic Officer

  • · Miller, J. (2015). Contemporary modes of probation officer supervision: The triumph of the “synthetic” officer?. Justice Quarterly, 32(2), 314-336.

·  Reading Three: Ewing – How Minor Violations

  •  
  • Ewing, M. (2017). How minor probation violations can lead to major jail time. The Atlantic. Retrieved: https://www.theatlantic.com/politics/archive/2017/06/philadelphia-detainer-holds/529758/

2) Review the“Ethical Community Corrections” PowerPoint

3) Watch this John Oliver piece on prisoner re-entry  (https://www.youtube.com/watch?v=gJtYRxH5G2k)

4) Watch this ‘To Prison for Poverty (https://www.youtube.com/watch?v=mn_yKqf-kOI&list=PLg4Wyfuz7faHMaaetvj1sYu1li4nN-Oh5)

5) After reviewing the materials, post a brief reflection in which you address AT LEAST THREE of the questions below. Make sure that your post cites AT LEAST TWO of this week’s assigned readings AND AT LEAST ONE video clip, and be sure that your post and reply fulfill Discussion Post requirements.

A) Of the four main types of community corrections officers discussed in the reading (the Law Enforcers, Time Servers, Therapeutic Agents, and Synthetic Officers), which type do you think is best/most effective?

  • Which of our primary ethical perspectives (formalism/deontology or utilitarianism/teleology) informs this role? Explain.

B) Is it ethical to subject offenders to paying for things that they are made to do by the courts (even if they don’t have the money)? Explain, using one of the dominant ethical perspectives to support your reasoning.

C) The average case load for probation officers across the U.S. is currently about at least 150 probationers. Identify two strategies/things that community corrections officers can do to ethically and effectively manage such heavy workloads in a political and social environment that is not likely to support any significant increases in funding for correctional programs

D) Imagine you are a community corrections officer working for a privately owned probation management firm. You don’t make much money, you have a heavy caseload, and your superiors heavily emphasize the importance of enforcing ALL probation conditions – no matter what.

  • Which probation violations would you be most likely to enforce (curfew? employment? clean drug testing (which types of drugs)?) and which would you be more likely to overlook?
  • Explain your reasoning and the ethical underpinnings of your approach –why is what you are doing best for the offender and for the community?

Throughout the quarter, you will be responsible for engaging in class discussions based on selected class materials. These discussions will find you posting your thoughts and replying to peers. Online class discussions will consist of:

I) REFLECTIVE DISCUSSION POSTS: Approximately every other week of this quarter will find you writing and posting reflective discussions of AT LEAST 350 WORDS (approximately the equivalent of three quarters of one double-spaced page in a word document) to the appropriate thread on the course discussion board. I will provide specific discussion topics and guidelines for exactly what you should write your reflection about. Reflection/discussion posts should be written in a scholarly manner and demonstrate you have read, understood, and thoughtfully considered the material. It is important that you read and synthesize the concepts, theories, and ideas we’ll be discussing and be prepared to explain them IN YOUR OWN WORDS.

  • While every reflection post MUST directly refer to AND cite the week’s assigned readings, YOU MAY NOT USE ANY DIRECT QUOTES IN DISCUSSION POSTS.
    •  
  • This prohibition against using direct quotes means that you will be drawing from the assigned readings and materials by synthesizing ideas, paraphrasing important points, and discussing the authors’ points in your own words. As such, it’s important that you utilize in-text citations when drawing on resources and that all sources cited in the body of your discussions are included in a “Works Cited” section at the close of each post.
  • For additional guidance regarding WHEN and HOW to cite, please see:
    •  
      •  
        •  
  • When You Must Cite 
  • APA Citation Format: In-Text Citations
  • APA Citation Format: Works-Cited Section
  • Whenever appropriate, posts should include relevant references and information you have learned in previous courses, from earlier readings in this course, and from other outside scholarly sources such as journal articles and books.
  • As these reflections account for 40% of your final grade, it is in your best interest to spend a good deal of time carefully crafting each post.    
  • Please demonstrate critical thinking through a willingness to question your own pre-existing ideas and perspectives onvarious topics. Also, don’t be afraid to challenge the authors: In other words, questions about/critiques of authors’ and researchers’ methods, assumptions, conclusions, and perspectives should form within your own mind as you read.

II) CRITICAL THINKING DISCUSSION QUESTIONS: At the end of each reflection/discussion post, provide AT LEAST TWO questions related to the assigned readings/material that you think would be interesting for the class to discuss.

  • Discussion questions MUST BE in-depth, interesting questions that require your classmates to draw on the assigned materials and readings: THESE ARE NOT OPINION QUESTIONS! The goal is to inspire sophisticated and analytical conversation; thus, it is important to take the time construct thoughtful, answerable questions that are clear, engaging, and relevant to the topic and reading(s) for the week.
  • Make the section with your discussion questions separate from the rest of your reflection by including an extra empty line before the discussion questions makes the questions easier to see.
  • Discussion questions DO NOT count as part of the 350-word minimum required of initial reflection posts.